Factor 5 - PDFSEARCH.IO - Document Search Engine

Factor 5
Results: 545

#	Item
241	Table 1s. Primer sequences used for RT-PCR analyses. Gene Size Primer Sequence (5’ to 3’) ABCG2 684 bp hABCG2-F gtttatccgtggtgtgtctgg hABCG2-R ctgagctatagaggcctggg Add to Reading List Source URL: www.grc.nia.nih.gov Language: English - Date: 2007-10-11 22:01:00 RE1-silencing transcription factor Zinc finger Biology Transcription factors Gene expression
242	Human Molecular Genetics, 2006, Vol. 15, No. 5 doi:[removed]hmg/ddi484 Advance Access published on January 18, [removed]–716 Add to Reading List Source URL: www.geneimprint.com Language: English - Date: 2012-06-22 09:56:01 Chemistry Genomic imprinting H19 Insulin-like growth factor 2 Bisulfite sequencing Methylation DNA methylation DNA methyltransferase Polymerase chain reaction Genetics Biology Epigenetics
243	1-(Thiophen-2-yl)-N-(4-{(E)-[(thiophen-2-yl)methyl]iminomethyl}benzylidene)methanamine Add to Reading List Source URL: journals.iucr.org Language: English - Date: 2014-04-05 02:12:44 C3a Complement factor I Complement system Complement component 4 Complement component 5
244	AND8019/D Offline Converter Provides 5.0 Volt, 1.0 Amp Output for Small Electronic Equipment Prepared by: Alan Ball ON Semiconductor Add to Reading List Source URL: www.intusoft.com Language: English - Date: 2011-03-23 12:48:47 Analog circuits Electronic circuits Voltage regulator Load regulation Linear regulator Switched-mode power supply Power supply Comparator Power factor Electromagnetism Electrical engineering Electronic engineering
245	June 5, 2013 volume 12 issue 22 Feature Article Four Facts Outside Counsel Should Factor into Add to Reading List Source URL: smithrolfes.com Language: English - Date: 2013-06-25 15:48:21 X Window System Email Lawyer Software Computing Freedesktop.org
246	Intestinal Tumorigenesis Initiated by Dedifferentiation and Acquisition of Stem-Cell-like Properties Sarah Schwitalla,1 Alexander A. Fingerle,2 Patrizia Cammareri,5 Tim Nebelsiek,1 Serkan I. Go¨ktuna,1 Paul K. Ziegler,1 Add to Reading List Source URL: openwetware.org Language: English - Date: 2013-01-28 13:47:07 Programmed cell death Transcription factors Stem cells Beta-catenin NF-κB Catenin Tumor necrosis factor-alpha Colorectal cancer IKK2 Biology Signal transduction Genes
247	[removed]New ISI Impact Factor 5.454 Add to Reading List Source URL: www.oakland.edu Language: English - Date: 2012-10-15 14:12:53 Chemistry: A European Journal Wiley-VCH Chemistry Nanotechnology Chemical bond Publishing Physics Science Emerging technologies Chemical bonding Halogen bond
248	Math Solutions Lesson from the Classroom Factor Game A Lesson for Grade 5 Add to Reading List Source URL: mathsolutions.com Language: English - Date: 2013-09-11 21:02:38 Mathematical notation Multiplication 24 Game Von Neumann algebra Prime number Number 9 Mathematics Elementary arithmetic Integer sequences
249	EUROPEAN ACADEMIC RESEARCH, VOL. I, ISSUE 5/ AUGUST 2013 ISSN[removed], www.euacademic.org IMPACT FACTOR: [removed]GIF) Library and Information Service Delivery for the Blind and Physically Challenged in University of Add to Reading List Source URL: euacademic.org Language: English - Date: 2014-09-14 05:40:22 Accessibility Assistive technology Braille Braille literacy Special education New York State Library Grade 2 braille Low vision Books for the Blind Blindness Disability Health
250	Microsoft Word - ElitCorrelationsGrades3-5.doc Add to Reading List Source URL: www.dnr.state.md.us Language: English - Date: 2015-01-12 15:54:52 Culture Sociology of culture G factor Scientific method Big Five personality traits Knowledge Education Educational psychology Science Anthropology

UPDATE